IJCS | Volume 32, Nº1, January/ February 2019

57 Table 1 - Echocardiographic parameters according to angiotensin-converting enzyme (ACE) (Deletion/Insertion, D/I) DD n (%) DI n (%) II n (%) N 17 59 27 EF (%) 0.664 Mean 43.8 42.3 44.9 Standard deviation 14.8 11.6 13.0 LVDD 0.879 Mean 59.2 60.3 59.7 Standard deviation 9.7 7.6 8.1 LVSD 0.753 Mean 48.6 50.6 49.3 Standard deviation 12.8 9.7 11.0 LAV 0.068 Mean 44.9 40.9 38.2 Standard deviation 10.1 9.6 7.8 * ANOVA test. LAV: left atrial volume; DD: deletion/deletion; DI: deletion/insertion; LVDD: left ventricular diastolic diameter; LVSD: left ventricular systolic diameter; EF: ejection fraction; I/I: insertion/insertion. Silva et al. ACE polymorphism and echocardiographic data in HF Int J Cardiovasc Sci. 2019;32(1)55-60 Original Article Genetic analysis Blood (8 mL) was collected in tubes containing EDTA, and submitted to DNA extraction. Subsequently, polymorphismgenotypingwas performedbypolymerase chain reaction (PCR) and classified as DD, DI or II. One pair of primers was used to amplify the D and I alleles, resulting in 319-bp (base pairs) and 597 bp amplicons. Hace 3,5’GCCCTGCAGGTGTCTGCAGCATGT3’ Hace 3,5’GGATGGCTCTCCCCGCCTTGTCTC3’ The protocol of PCR using a thermal cycle consisted of a cycle of denaturation at 94ºC for 30 seconds, annealing at 56ºC for 45minutes and extension at 72ºC for 7minutes. Amplification products of the D and I alleles were identified using an ultraviolet transilluminator. Since the D allele in heterozygous samples is preferentially amplified, each sample initially found to have the DD genotype was equally subjected to a second, independent amplification with a primer pair that recognizes an insertion-specific sequence with identical PCR conditions except for an annealing temperature of 67ºC. 16 Hace 5’,5’TGGGACCACAGCGCCCGCCACTAC3’ Hace 5’,5’ TCGCCAGCCCTCCCATGCCCATAA3’ Statistical analysis The Shapiro-Wilk test was used for testing normality of data. Mean and standard deviation of EF, LVDD, LVSD and LAVwere calculated for patients grouped according to ACE polymorphism (DD, DI and II). Differences in echocardiographic parameters between these groups were compared by analysis of variance (ANOVA, F test). P-values lower than 0.05 were considered statistically significant. Analysis was performed using the SPSS software version 18.0. Echocardiographic parameters (EF, LVDD, LVSD and LAV) were treated as continuous variables with normal distribution, and the DD. DI and II genotypes treated as categorical variables. Results A total of 103 patients with HF caused by Chagas disease, mean age of 62.4 years (36 – 95 years), 63% men, were included in the study. All patients were on optimized drug therapy according to current guidelines. Genotypic distribution of the ACE polymorphism was 16.5% DD, 57.3% DI and 26.2% II. No statistically