IJCS | Volume 33, Nº3, May / June 2020

256 Table 1 – PCR conditions for the analysis of SNPs in IL8 and IL16 genes SNP Primers Amplification conditions Fragment size Reference IL8 rs4073 (A/T) F: 5’ CATGATAGCATCTGTAATTAAC 3’ 5’ CTCATCTTTTCATTATGTCAGA 3’ 1) 95°C – 5 min 2) 95°C – 1min 3) 57°C – 1 min 4) 72°C – 1 min 5) 72°C – 5 min 348 bp Andia, et al (2013) 19 IL16 rs11556218 (G/T) F: 5' GCTCAGGTTCACAGAGTGTTTCCATA 3’ R: 5' TGTGACAATCACAGCTTGCCTG 3’ 1) 94°C – 4 min 2) 94°C – 30 seg 3) 60°C – 30 seg 4) 72°C – 30 seg 5) 72°C – 5 min 171 bp Wu, et al (2011) 15 Amplification conditions: 1 and 2: Initial denaturation; 3: Ringing; 4 and 5: Extension. PCR: polymerase chain reaction; SNP: single-nucleotide polymorphism. Silva et al. Polymorphisms in acute coronary syndrome Int J Cardiovasc Sci. 2020; 33(3):254-262 Original Article frequencies were analyzed by the G Williams test and Odds Ratio (OR) with 95% confidence intervals. The multivariate logistic regression model was used to evaluate the association between genetic polymorphisms and risk factors for ACS. Data were considered statistically significant where p < 0.05. Continuous variables were expressed as means and standard deviation (SD) or medians (cytokine dosages). Categorical variables were expressed in absolute and relative values. Kolmogorov-Smirnov or Shapiro-Wilk tests were used to evaluate normality in the continuous variables. Assuming that the quantitative data did not follow normal distribution, non-parametric tests were applied. Kruskal-Wallis test was used to compare the variation of their concentrations between the groups. Multivariate analysis was performed using a multivariate logistic regression model to evaluate the association between genetic polymorphisms and risk factors for ACS. In the analysis of all the data was used the program BioEstat 5.0. Results The distributions of the genotypic frequencies are in accordance with the Hardy-Weinberg equilibrium. The mean age found in the groups withACS, without ACS and blood donors was 62 (± 13.0), 58 (± 18.9) and 48 (± 6.3) years old, respectively. The male gender was the most frequent in the three groups evaluated (76.5%, 58% and 85.4%, respectively). The majority of patients withACS and non-ACS were non-smokers (69.5% and 82%, respectively) and non- diabetics (55.5% and 68%, respectively). Hypertensive patients accounted for 80.5% of patients with ACS and dyslipidemia was present in 64% of ACS patients and only 14% of those without ACS. Results for the rs4073 (IL8) SNP demonstrated a higher frequency of the AT genotype in all groups analyzed. For SNP rs11556218 (IL16), the most frequent genotype in all 3 groups was TT. In addition, TG genotype showed higher frequency in blood donor individuals (35.5%) compared to ACS patients (21.0%; p = 0.002). G allele carriers (TG + GG) were more present in donor subjects (36%) than in patients withACS (23%) (p = 0.0052). When comparing the groups withACS and without ACS, no difference was found in the genotypic distribution (Table 2). When genetic polymorphisms were evaluated in relation to the main risk factors for ACS (smoking, diabetes, hypertension and dyslipidemias), the IL8 gene showed no association. The rs11556218 SNP in the IL16 gene showed statistical association when analyzed against risk factors hypertension (p = 0.002) and dyslipidemias (p = 0.01) (Table 3). From the results of the genotyping for the polymorphisms and considering the significant association between the SNP rs11556218 in the IL16 gene and SCA, the cytokine IL-16 was dosed. For this, 20 samples from patients with ACS (TT = 9),