ABC | Volume 112, Nº2, February 2019

Original Article Arq Bras Cardiol. 2019; 112(2):154-162 Naderi et al Garlic and exercise increase cardiac angiogenesis MiRs are small non-coding RNAs that function in RNA silencing and the post-transcriptional regulation of gene expression. 10 MiRs are essential intracellular mediators in many processes such as inflammation, mitochondrial metabolism, apoptosis, and angiogenesis, which can be adjusted through exercise. 11 Therefore, miRs can be clinically useful in the treatment of several disorders. Moreover, miRs are released in urine and in the bloodstream following tissue injury, which makes them useful biomarkers for early detection, diagnosis, and prognosis of disorders. Recently, these molecules have been found to be involved in cardiovascular diseases. 12 This includes a high expression of miR-126 in the heart endothelium, as well as its involvement in angiogenesis. 12,13 Circulating levels of miR-126 are reduced in diabetes, 14,15 suggesting that its deficiency may impair vascularisation. 16 Moreover, Fasanaro et al. 17 reported that hypoxia-driven miR- 210 supports angiogenic response in endothelial cells and that its blockade by anti-miR transfection inhibits the formation of capillary-like structures. 17 Many diabetes complications are well-known to be associated with lipid disorders. Indeed, dyslipidemia impairs numerous organs and is recognized as an important factor of many diabetic complications, including vascular abnormalities. 18 Therefore, the aimof this study was to investigate the effect of voluntary exercise and garlic treatment alone or in combination on miR-126 and miR-210 expressions, serum lipid profile, as well as their relationship with cardiac angiogenesis in diabetes. Methods Animals and Experimental Design The Ethics Committee for Animal Experiments approved the study plan, and all experiments were conducted in accordance with the National Institute of Health’s Guide for the Care and Use of Laboratory Animals. Male Wistar rats (200-250 g) were provided by our university’s colony. All animals were housed in a temperature-controlled facility (21-23°C) maintained on a 12:12-h light-dark cycle, with food and water provided ad libitum. In this study, thirty-five male rats were divided into five groups (n = 7): Control, Diabetes, Diabetes+Garlic, Diabetes+Exercise, and Diabetes+Garlic+Exercise. Control animals received 0.4 mL of sodium citrate buffer, pH 4.5. Diabetes was induced using a single intraperitoneal dose (50 mg/kg) of Streptozotocin (Sigma, St. Louis, Mo, USA). Blood glucose level was measured 72 hours later using a glucometer (Elegance, Model: no: CT-X10 Germany), and induced diabetes was identified if blood glucose level was > 300 mg/dL (16.67 mmol/L). In this study, sample size was determined based on our similar previous studies. 8,19 Voluntary exercise Rats in the voluntary exercise groups were housed individually in cages with stainless-steel running wheels (1.00m circumference, TajhizGostar) and were allowed free access to the wheel 24 h per day for 6 weeks. Running distance was monitored daily. If the running distance was below 2000 m/day, that animal was excluded from the study. Sedentary rats were housed in standard holding cages without running wheels for the same period. Preparing Garlic Homogenate Garlic (Allium sativum) bulbs were purchased from a local market. Cloves were peeled, sliced, ground into a paste and then dissolved in distilled water. The garlic homogenate was freshly prepared each day. Sampling At the end of the 6 th week, the rats were deeply anesthetized with pentobarbital sodium (35 mg/kg, i.p.), blood samples were collected from the inferior vena cava to measure lipid profile. Then the heart was quickly removed through midsternal thoracotomy and the left ventricle was excised, frozen in liquid nitrogen, and stored at deep freeze (-70°C) for later measurements. The myocardiumwas used for miR extraction, real-time PCR study and angiogenesis determination. MiR Extraction and Real-Time PCR MiR was extracted from the myocardium using miRCURYTMRNA isolation kit (Exiqon, Vedbaek, Denmark) according to the manufacturer’s protocol. 20,21 The procedure was performed based on the spin column using a proprietary resin as a matrix to separate RNA from other cell components. RNA content and purity were measured using the Nanodrop 1000 spectrophotometer (Thermo scientific, Wilmington, DE 19810 USA). MiR-126 expression profile was obtained for total RNA extracts using universal a cDNA synthesis kit. Briefly, total RNA containing microRNA was polyadenylated and cDNA was synthesized using a poly(T) primer with a 3’ degenerate anchor and a 5’ universal tag (Exiqon, Vedbaek, Denmark). Each cDNA was used as a template for microRNA quantitative real-time PCR by using the SYBR Green master mix (Exiqon, Vedbaek, Denmark). LNA (Locked Nucleic Acid) forward and reverse primer sets (Exiqon, Vedbaek, Denmark) for microRNA are listed in Table 1. Real-time PCR reactions were performed with a Bio-Rad iQ5 detection System (Bio-Rad, Richmond, Table 1 – Target sequence list for miRs Gene name Accession number Target sequence* rno-miR-191 MIMAT0000440 CAACGGAAUCCCAAAAGCAGCUG hsa-miR-126 MIMAT0002957 UCGUACCGUGAGUAAUAAUGC dme-miR- 210 MIMAT0001233 UUGUGCGUGUGACAGCGGCUA * Sequences were derived from miRBase (www.mirbase.org ). 155